Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7121028
End position: 7121051
Length: 24

DNA sequence
>NC_009142, from 7121028 to 7121051 (24 bp); Saccharopolyspora erythraea NRRL 2338 CCGAACCCGCACCTGAACCCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7120469-7121341	Sequence	SACE_6358 - cell wall surface anchor family protein (Protein is coded in complementary strand; from 7121341 to 7120469)