Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7130179
End position: 7130202
Length: 24

DNA sequence
>NC_009142, from 7130179 to 7130202 (24 bp); Saccharopolyspora erythraea NRRL 2338 GACGCCGACGCGGATGCCGATGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7129865-7131088	Sequence	SACE_6365 - FAD linked oxidase-like protein (Protein is coded in complementary strand; from 7131088 to 7129865)