Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7134225
End position: 7134248
Length: 24

DNA sequence
>NC_009142, from 7134225 to 7134248 (24 bp); Saccharopolyspora erythraea NRRL 2338 CCGTGGCCGTGCCCGAGGCCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7133730-7134890	Sequence	SACE_6368 - type I phosphodiesterase/nucleotide pyrophosphatase (Protein is coded in complementary strand; from 7134890 to 7133730)