Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7199455
End position: 7199478
Length: 24

DNA sequence
>NC_009142, from 7199455 to 7199478 (24 bp); Saccharopolyspora erythraea NRRL 2338 AGCAGCAGGAGCTGCAGCAGCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7199296-7199727	Sequence	SACE_6424 - hypothetical protein (Protein is coded in complementary strand; from 7199727 to 7199296)