Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7220997
End position: 7221020
Length: 24

DNA sequence
>NC_009142, from 7220997 to 7221020 (24 bp); Saccharopolyspora erythraea NRRL 2338 GCTCGGGCGCGGGCTCCGGCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7220651-7223512	Sequence	SACE_6442 secA1 preprotein translocase subunit SecA (Protein is coded in complementary strand; from 7223512 to 7220651)