Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7223938
End position: 7223961
Length: 24

DNA sequence
>NC_009142, from 7223938 to 7223961 (24 bp); Saccharopolyspora erythraea NRRL 2338 CTCCTCCTGCTCCTCCTGCTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7223681-7224376	Sequence	SACE_6443 - S30AE family protein (Protein is coded in complementary strand; from 7224376 to 7223681)