Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7269688
End position: 7269711
Length: 24

DNA sequence
>NC_009142, from 7269688 to 7269711 (24 bp); Saccharopolyspora erythraea NRRL 2338 GCGTCGGCGACGGCCTCGGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7268920-7269843	Sequence	SACE_6479 rfbD dTDP-4-dehydrorhamnose reductase (Protein is coded in complementary strand; from 7269843 to 7268920)