Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7528670
End position: 7528693
Length: 24

DNA sequence
>NC_009142, from 7528670 to 7528693 (24 bp); Saccharopolyspora erythraea NRRL 2338 CGGCGACGGCAACGACGACGGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7527310-7528890	Sequence	SACE_6720 phoD phosphodiesterase/alkaline phosphatase D