Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7566784
End position: 7566807
Length: 24

DNA sequence
>NC_009142, from 7566784 to 7566807 (24 bp); Saccharopolyspora erythraea NRRL 2338 CAGGCGCAGCCGCAGGGGCAGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7566401-7566886	Sequence	SACE_6759 - hypothetical protein (Protein is coded in complementary strand; from 7566886 to 7566401)