Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7583383
End position: 7583406
Length: 24

DNA sequence
>NC_009142, from 7583383 to 7583406 (24 bp); Saccharopolyspora erythraea NRRL 2338 CTCGGCCTCGGCCTCCGCCACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7583246-7584580	Sequence	SACE_6779 glmM phosphoglucomutase/phosphomannomutase (Protein is coded in complementary strand; from 7584580 to 7583246)