Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7590973
End position: 7590996
Length: 24

DNA sequence
>NC_009142, from 7590973 to 7590996 (24 bp); Saccharopolyspora erythraea NRRL 2338 CGGCGGCGGGGGCGGAGGCGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7590344-7591738	Sequence	SACE_6786 - PE-PGRS family protein (Protein is coded in complementary strand; from 7591738 to 7590344)