Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7618931
End position: 7618954
Length: 24

DNA sequence
>NC_009142, from 7618931 to 7618954 (24 bp); Saccharopolyspora erythraea NRRL 2338 ATCACGATGACGATGACGATCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7618118-7619431	Sequence	SACE_6813 secY preprotein translocase subunit SecY (Protein is coded in complementary strand; from 7619431 to 7618118)