Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7644879
End position: 7644902
Length: 24

DNA sequence
>NC_009142, from 7644879 to 7644902 (24 bp); Saccharopolyspora erythraea NRRL 2338 GGCTGCGGCTGCGGCTGCGGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7643778-7647305	Sequence	SACE_6845 - hypothetical protein (Protein is coded in complementary strand; from 7647305 to 7643778)