Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7782097
End position: 7782120
Length: 24

DNA sequence
>NC_009142, from 7782097 to 7782120 (24 bp); Saccharopolyspora erythraea NRRL 2338 TCGTCGTCGTCGGCGTCGTCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7781827-7783212	Sequence	SACE_6963 - hypothetical protein (Protein is coded in complementary strand; from 7783212 to 7781827)