Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7976074
End position: 7976097
Length: 24

DNA sequence
>NC_009142, from 7976074 to 7976097 (24 bp); Saccharopolyspora erythraea NRRL 2338 CTCCTGCTCCTCCGCCTGCTCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7976045-7977514	Sequence	SACE_7171 - mucin-associated surface protein (Protein is coded in complementary strand; from 7977514 to 7976045)