Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 8015602
End position: 8015625
Length: 24

DNA sequence
>NC_009142, from 8015602 to 8015625 (24 bp); Saccharopolyspora erythraea NRRL 2338 CGGCGGCGCCGGCGCCGGCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8015490-8017358	Sequence	SACE_7210 dnaK molecular chaperone DnaK (Protein is coded in complementary strand; from 8017358 to 8015490)