Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 8052086
End position: 8052109
Length: 24

DNA sequence
>NC_009142, from 8052086 to 8052109 (24 bp); Saccharopolyspora erythraea NRRL 2338 CGCCGCGCTGCCGCGCCGCCCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8051401-8052741	Sequence	SACE_7247 - N-ethylammeline chlorohydrolase (Protein is coded in complementary strand; from 8052741 to 8051401)