Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 8209927
End position: 8209950
Length: 24

DNA sequence
>NC_009142, from 8209927 to 8209950 (24 bp); Saccharopolyspora erythraea NRRL 2338 ACGTCGAGGTCGATGTCGCCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8209561-8210109	Sequence	SACE_7393 - single-stranded nucleic acid binding R3H (Protein is coded in complementary strand; from 8210109 to 8209561)