Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 8210824
End position: 8210847
Length: 24

DNA sequence
>NC_009142, from 8210824 to 8210847 (24 bp); Saccharopolyspora erythraea NRRL 2338 ACCGGCACCTGCACCAGCATCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8210143-8211153	Sequence	SACE_7394 - inner membrane protein translocase component YidC (Protein is coded in complementary strand; from 8211153 to 8210143)