Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 206383
End position: 206407
Length: 25

DNA sequence
>NC_009142, from 206383 to 206407 (25 bp); Saccharopolyspora erythraea NRRL 2338 CGGCGCTGCGCGGGGCCGCGCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 205651-208779	Sequence	SACE_0178 embC arabinosyltransferase, membrane protein