Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 2568524
End position: 2568548
Length: 25

DNA sequence
>NC_009142, from 2568524 to 2568548 (25 bp); Saccharopolyspora erythraea NRRL 2338 CGGCCGGGCCCGGCTGGGCCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2567442-2569064	Sequence	SACE_2367 fadD2 acyl-CoA synthetase (Protein is coded in complementary strand; from 2569064 to 2567442)