Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 5689615
End position: 5689639
Length: 25

DNA sequence
>NC_009142, from 5689615 to 5689639 (25 bp); Saccharopolyspora erythraea NRRL 2338 CGGCGGGGCGCGCCGCAGCGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5689322-5690971	Sequence	SACE_5100 - CRISPR-associated Cas1/Cas4 family protein