Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 6403078
End position: 6403102
Length: 25

DNA sequence
>NC_009142, from 6403078 to 6403102 (25 bp); Saccharopolyspora erythraea NRRL 2338 CGCGGCGCGAGGCGGCGCTGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6402760-6403422	Sequence	SACE_5700 - TetR family transcriptional regulator