Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 6561714
End position: 6561738
Length: 25

DNA sequence
>NC_009142, from 6561714 to 6561738 (25 bp); Saccharopolyspora erythraea NRRL 2338 GCGCGGCGCCGGGCGGCTCGGCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6560956-6562176	Sequence	SACE_5845 nos nitric oxide synthase oxygenase (Protein is coded in complementary strand; from 6562176 to 6560956)