Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7716882
End position: 7716906
Length: 25

DNA sequence
>NC_009142, from 7716882 to 7716906 (25 bp); Saccharopolyspora erythraea NRRL 2338 CCCAGGCCAGCCCGGCCGAGCGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7716344-7717693	Sequence	SACE_6899 nuoD NADH dehydrogenase subunit D (Protein is coded in complementary strand; from 7717693 to 7716344)