Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 1084792
End position: 1084818
Length: 27

DNA sequence
>NC_009142, from 1084792 to 1084818 (27 bp); Saccharopolyspora erythraea NRRL 2338 CTCCTCGTCCTCCTCGTACTCCGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1084778-1085284	Sequence	SACE_0970 gvpJ gas vesicle protein (Protein is coded in complementary strand; from 1085284 to 1084778)