Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 1088488
End position: 1088514
Length: 27

DNA sequence
>NC_009142, from 1088488 to 1088514 (27 bp); Saccharopolyspora erythraea NRRL 2338 CTTGCCGCCCTTGCCGCCCTTGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1087688-1088842	Sequence	SACE_0975 - hypothetical protein (Protein is coded in complementary strand; from 1088842 to 1087688)