Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 1529882
End position: 1529908
Length: 27

DNA sequence
>NC_009142, from 1529882 to 1529908 (27 bp); Saccharopolyspora erythraea NRRL 2338 CGGTGGCGGCGGTGTCGGGGGTGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1529032-1531350	Sequence	SACE_1383 - oxidoreductase alpha (molybdopterin) subunit (Protein is coded in complementary strand; from 1531350 to 1529032)