Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 1726216
End position: 1726242
Length: 27

DNA sequence
>NC_009142, from 1726216 to 1726242 (27 bp); Saccharopolyspora erythraea NRRL 2338 GCTCCAGCAGCTCCGGCAGCGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1725885-1727096	Sequence	SACE_1572 - hypothetical protein (Protein is coded in complementary strand; from 1727096 to 1725885)