Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 1984075
End position: 1984101
Length: 27

DNA sequence
>NC_009142, from 1984075 to 1984101 (27 bp); Saccharopolyspora erythraea NRRL 2338 ACCGCGTCGACCGCGACGACCGCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1983841-1985244	Sequence	SACE_1801 sigA RNA polymerase sigma factor (Protein is coded in complementary strand; from 1985244 to 1983841)