Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 2331319
End position: 2331345
Length: 27

DNA sequence
>NC_009142, from 2331319 to 2331345 (27 bp); Saccharopolyspora erythraea NRRL 2338 GTGCTGCTGGTGCTGCTGGTGCTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2331281-2331514	Sequence	SACE_2146 secG preprotein translocase subunit SecG