Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 277076
End position: 277102
Length: 27

DNA sequence
>NC_009142, from 277076 to 277102 (27 bp); Saccharopolyspora erythraea NRRL 2338 TGGGACGGCTGGGACGGCTGGGACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 276588-277157	Sequence	SACE_0240a - hypothetical protein (Protein is coded in complementary strand; from 277157 to 276588)