Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 3316891
End position: 3316917
Length: 27

DNA sequence
>NC_009142, from 3316891 to 3316917 (27 bp); Saccharopolyspora erythraea NRRL 2338 GCCGTTGCCGCCGTTGCCGCCGTTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3315785-3317287	Sequence	SACE_3025 - PE-PGRS family protein (Protein is coded in complementary strand; from 3317287 to 3315785)