Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 3682874
End position: 3682900
Length: 27

DNA sequence
>NC_009142, from 3682874 to 3682900 (27 bp); Saccharopolyspora erythraea NRRL 2338 GCTTGGCCGGCTTGGCCGCCTTGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3682636-3684462	Sequence	SACE_3331 recQ ATP-dependent DNA helicase (Protein is coded in complementary strand; from 3684462 to 3682636)