Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 3790808
End position: 3790834
Length: 27

DNA sequence
>NC_009142, from 3790808 to 3790834 (27 bp); Saccharopolyspora erythraea NRRL 2338 CGGCGATGTCGGCGATCTCGGCGACGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3789334-3790968	Sequence	SACE_3434 - purine catabolism PurC-like protein (Protein is coded in complementary strand; from 3790968 to 3789334)
ORF... 3790814-3791125	Sequence	SACE_3435 - hypothetical protein