Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 3985798
End position: 3985824
Length: 27

DNA sequence
>NC_009142, from 3985798 to 3985824 (27 bp); Saccharopolyspora erythraea NRRL 2338 TGCGCAACCTGCGCGACCTGCGCACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3985660-3986226	Sequence	SACE_3629 - TetR family transcriptional regulator