Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 4440010
End position: 4440036
Length: 27

DNA sequence
>NC_009142, from 4440010 to 4440036 (27 bp); Saccharopolyspora erythraea NRRL 2338 CGGCTACGTCGGCTACTTCGGCTACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4439031-4441181	Sequence	SACE_4036 pabAB para-aminobenzoic acid synthase