Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 4675210
End position: 4675236
Length: 27

DNA sequence
>NC_009142, from 4675210 to 4675236 (27 bp); Saccharopolyspora erythraea NRRL 2338 GCGCTCGGCGCGGTCGGCGAGCTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4674665-4676131	Sequence	SACE_4203 gbsA glycine betaine aldehyde dehydrogenase (Protein is coded in complementary strand; from 4676131 to 4674665)