Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 522053
End position: 522079
Length: 27

DNA sequence
>NC_009142, from 522053 to 522079 (27 bp); Saccharopolyspora erythraea NRRL 2338 TGGGACGGCTGGGACGGCTGGGACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 521856-522134	Sequence	SACE_0465a - hypothetical protein (Protein is coded in complementary strand; from 522134 to 521856)