Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 5795262
End position: 5795288
Length: 27

DNA sequence
>NC_009142, from 5795262 to 5795288 (27 bp); Saccharopolyspora erythraea NRRL 2338 GGCCAGCGCGGCCAGCACCGCCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5794318-5795304	Sequence	SACE_5183 - hypothetical protein (Protein is coded in complementary strand; from 5795304 to 5794318)