Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 6193884
End position: 6193910
Length: 27

DNA sequence
>NC_009142, from 6193884 to 6193910 (27 bp); Saccharopolyspora erythraea NRRL 2338 CCACCGCGACCAGCGCGACCACCACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6193721-6195175	Sequence	SACE_5517 - hypothetical protein (Protein is coded in complementary strand; from 6195175 to 6193721)