Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 6926563
End position: 6926589
Length: 27

DNA sequence
>NC_009142, from 6926563 to 6926589 (27 bp); Saccharopolyspora erythraea NRRL 2338 CCGGCCTCCCCGGCCTCGCCGGACTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6926551-6927276	Sequence	SACE_6178 - hypothetical protein (Protein is coded in complementary strand; from 6927276 to 6926551)