Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7239687
End position: 7239713
Length: 27

DNA sequence
>NC_009142, from 7239687 to 7239713 (27 bp); Saccharopolyspora erythraea NRRL 2338 ATCGGCACCAGCGGCACCATCGGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7239498-7240982	Sequence	SACE_6455 - amino acid permease (Protein is coded in complementary strand; from 7240982 to 7239498)