Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 7313666
End position: 7313692
Length: 27

DNA sequence
>NC_009142, from 7313666 to 7313692 (27 bp); Saccharopolyspora erythraea NRRL 2338 GCCGCCGTGGCCGCCGTGGCCGCCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7313592-7313906	Sequence	SACE_6519 - PE-PGRS family protein (Protein is coded in complementary strand; from 7313906 to 7313592)