Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 8054927
End position: 8054953
Length: 27

DNA sequence
>NC_009142, from 8054927 to 8054953 (27 bp); Saccharopolyspora erythraea NRRL 2338 GCGAGCACCGCGAGCACGGCCAGCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8053859-8055640	Sequence	SACE_7250 - hypothetical protein (Protein is coded in complementary strand; from 8055640 to 8053859)