Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 8165757
End position: 8165783
Length: 27

DNA sequence
>NC_009142, from 8165757 to 8165783 (27 bp); Saccharopolyspora erythraea NRRL 2338 GCGGCACCGGCGGCACCTGCCGCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8163309-8166629	Sequence	SACE_7356 pbp1A membrane carboxypeptidase (Protein is coded in complementary strand; from 8166629 to 8163309)