Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 1604994
End position: 1605023
Length: 30

DNA sequence
>NC_009142, from 1604994 to 1605023 (30 bp); Saccharopolyspora erythraea NRRL 2338 CGGCCCGGGGCGCGCCGGGGCTGCCCTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1604969-1605412	Sequence	SACE_1455 - hypothetical protein (Protein is coded in complementary strand; from 1605412 to 1604969)