Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 1671946
End position: 1671975
Length: 30

DNA sequence
>NC_009142, from 1671946 to 1671975 (30 bp); Saccharopolyspora erythraea NRRL 2338 GCCGATGCCGGTGCCGATGGCGATGCCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1671047-1672291	Sequence	SACE_1523 fabF 3-oxoacyl-ACP synthase (Protein is coded in complementary strand; from 1672291 to 1671047)