Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 2478600
End position: 2478629
Length: 30

DNA sequence
>NC_009142, from 2478600 to 2478629 (30 bp); Saccharopolyspora erythraea NRRL 2338 CGCGGTTGCGCGCGGTCGAGCACGGTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2477379-2478857	Sequence	SACE_2288 ppmB polyprenol phosphate mannosyl transferase 2