Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 4110061
End position: 4110090
Length: 30

DNA sequence
>NC_009142, from 4110061 to 4110090 (30 bp); Saccharopolyspora erythraea NRRL 2338 CAGCGCCCGCGCCAGAGCCCGCGCCAGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4109297-4111603	Sequence	SACE_3756 clpA Clp protease ATP binding subunit (Protein is coded in complementary strand; from 4111603 to 4109297)